FAM120AOS

FAM120AOS, or family with sequence similarity 120A opposite strand, codes for uncharacterized protein FAM120AOS, which currently has no known function.[3] The gene ontology describes the gene to be protein binding.[4] Overall, it appears that the thyroid and the placenta are the two tissues with the highest expression levels of FAM120AOS across a majority of datasets.

FAM120AOS
Identifiers
AliasesFAM120AOS, C9orf10OS, family with sequence similarity 120A opposite strand
External IDsHomoloGene: 131283 GeneCards: FAM120AOS
Orthologs
SpeciesHumanMouse
Entrez

158293

n/a

Ensembl

ENSG00000188938

n/a

UniProt

Q5T036

n/a

RefSeq (mRNA)

NM_198841
NM_001322224

n/a

RefSeq (protein)

NP_001309153
NP_942138

n/a

Location (UCSC)Chr 9: 93.43 – 93.45 Mbn/a
PubMed search[2]n/a
Wikidata
View/Edit Human

The microarray-assessed tissue expression pattern of multiple normal tissues for FAM120AOS in humans was found using GDS3834 data.[5] The three tissues in the 90th percentile and higher for FAM120AOS gene expression are as follows: the bladder, epididymis, and thyroid. The thyroid is in the 91st percentile, while the other two are in the 90th percentile. Since high thyroid expression was also seen across the RNA-seq data,[6][7][8][9] it appears that FAM120AOS expression may be important in the thyroid.

Gene

Common aliases

The common aliases for FAM120AOS are C9orf10OS, FLJ31534, LOC158293, and putative FAM120A opposite strand protein.[3]

Locus

There are two genomic locations for the gene, the first of which is chr9:93,431,441-93,453,601(GRCh38/hg38) with a length of 22,161 base pairs (bp), oriented on the minus strand of the chromosome.[10] The second genomic location for the gene is at chr9:96,208,776-96,215,874(GRCh37/hg19) with a length of 7,099 bp, also oriented on the minus strand of the chromosome.[10] The genes found upstream of FAM120AOS on chromosome 9 are FGD3, SUSD, C9orf89, WNK2, C9orf129, and NINJ1.[3] The genes found downstream from FAM120AOS on chromosome 9 are FAM120A and PHF2.[3]

Number of exons

The longest isoform of FAM120AOS in humans contains 3 exons.[4]

Span of gene

The mRNA transcript variant that encodes for human FAM120AOS isoform 1 is 5922 bp long and contains an upstream in-frame stop codon (taa) at 807-809 bp.[11]

Transcripts

There are 12 known isoforms of the human FAM120AOS gene.[4] The longest and most common transcript variant is isoform 1, which is 5922 bp in length.[4][12] Transcript variants 3-12 are all non-coding RNAs, meaning that they do not code for a protein.[4] The only isoforms that are protein-encoding are isoform 1 and 2 of the human FAM120AOS gene.[4]

Isoform 2 is 5008 bp in length and contains an alternate exon in the 5' UTR, is missing a portion of the 5' coding region, and initiates translation at an alternate start codon, in comparison to isoform 1.[4][13] The variant also has a shorter and more distinct N-terminus in comparison to isoform 1.[4]

Non-coding RNAS

All of the following variations mentioned are in comparison to isoform 1 of the human FAM120AOS gene. Isoform 3 is 2199 bp and uses an alternate splice site in the first exon.[4][14] The transcript variants (e.g. isoforms) 6-12 are all candidates for nonsense-mediated mRNA decay (NMD).[4]

Isoform 4 of the gene is 2320 bp and uses an alternate splice site in the first exon and contains an alternate internal exon.[4][15] Isoform 5 is 6043 bp and contains an alternate internal exon. Isoform 6 is 5272 bp and contains an alternate first exon and an alternate internal exon.[4][16] Isoform 7 is 5095 bp and contains an alternate first exon.[4][17] Isoform 8 is 5129 bp and contains an alternate first exon and alternate internal exon.[4][18] Isoform 9 is 5151 bp and contains an alternate first exon.[4][19] Isoform 10 is 5354 bp and contains an alternate first exon.[4][20] Isoform 11 is 5475 bp and contains an alternate first exon and an alternate internal exon.[4][21] Lastly, isoform 12 5216 is bp and contains an alternate first exon and an alternate internal exon.[4]

Proteins

Isoforms

There are two different isoforms of the human FAM120AOS gene that encode a protein, isoforms 1 and 2.[4] The uncharacterized protein FAM120AOS isoform 1 is 256 amino acids long[22] and the uncharacterized protein FAM120AOS isoform 2 is 74 amino acids long.[23] Uncharacterized protein FAM120AOS isoform 1 is the longer and more abundant isoform found in humans, and contains protein domain Q5T035.[4][10] The isoform also has a protein interactant, Q5T035-F120S_HUMAN, and CRISPR reagents and clone products of the protein available.[10]

Molecular weight

Uncharacterized protein FAM120AOS isoform 1 (protein isoform 1) in humans has a calculated molecular weight of 27.8 kDa.[4] A theoretical value of 11.93 for the isoelectric point of the protein was determined through the use of ExPASy.[24] The basic isoelectric point indicates that protein isoform 1 is primarily basic. Table 1 shows the isoelectric points and molecular weights for all the different orthologs of the human FAM120AOS protein 1 across Primates and Artiodactyla.[25] The isoelectric point of the protein remains within a pH of 10.05-11.93 across all orthologs, indicating that the protein is primarily basic. However, the molecular weight of the FAM120AOS protein seems to vary greatly between orthologs, ranging from values of 8.1 kDa to 17.9 kDa, with a maximum value of 29.8 kDa. Many of the sequences with a lower molecular weight were found to be composed of fewer amino acids than the sequences with larger molecular weights. These length differences could also be attributed to possible different isoforms of the FAM120AOS protein being analyzed.

Table 1: Isoelectric Point and Molecular Weight of FAM120AOS Protein Across Orthologs
Organism Taxonomic Group Isoelectric Point Molecular Weight (in kDa)
Homo sapiens Primates 11.93 27.9
Pan troglodytes Primates 11.92 27.7
Pongo abelii Primates 11.69 27.8
Nomascus leucogenys Primates 10.32 7.9
Hylobates moloch Primates 10.06 8.1
Trachypithecus francoisi Primates 11.35 8.1
Rhinopithecus roxellana Primates 11.57 8.3
Macaca nemestrina Primates 11.35 8.1
Papio anubis Primates 10.98 8.2
Carlito syrichta Primates 11.36 25.8
Microcebus murinus Primates 11.52 29.8
Muntiacus muntjak Artiodactyla 11.21 17.9

Amino acid composition

The image above shows the two areas of internal repeats identified in uncharacterized protein FAM120AOS isoform 1. The first internal repeat occurs at amino acid positions 41-59 and 88-105. The second internal repeat occurs at amino acid positions 145-153 and 160-168. The bolded amino acids indicate the repeated areas of the sequences.

Protein isoform 1 contains two different internal repeats in its amino acid composition, determined through analysis of the protein sequence using Dotlet JS.[26] The first internal repeat occurs at amino acid positions 41-59 and 88-105.[26] The second internal repeat occurs at amino acid positions 145-153 and 160-168.[26] There is an upstream in-frame stop codon (taa) present at amino acid positions 806-808.[4] There is an alternate polyadenylation site present at amino acid positions 2726-2731.[4] The polyadenylation signal used is present present from amino acid positions 5889-5893.[4] The amino acid positions from L206-S211, H213, H215, K219-P225, and K227-C233 were found to be conserved across all of the strict orthologs of the human uncharacterized protein FAM120AOS isoform 1.[27] The amino acid G95 was found to be conserved across all Primates and Artiodactyla for which sequences were identified.[27] The human FAM120AOS protein 1 was found to arginine-rich, and glutamic acid and tyrosine-poor.[28]

The image above shows the amino acids that are conserved across human uncharacterized FAM120AOS protein isoform 1 and 8 of its strict orthologs.[29] The purple-colored amino acids are fully conserved, while the pink ones are moderately conserved, and the blue ones are slightly conserved. The highlighted areas represent the exon boundaries of the protein. It appears that a large amount of amino acids coded by exon 2 and 3 of the gene were conserved across the strict orthologs of the protein.

Domains and motifs

The uncharacterized protein FAM120AOS isoform 1 in humans contains the protein domain Q5T035.[10]

Two notable motifs found using a eukaryotic linear motif analysis for the human FAM120AOS protein 1 are TRG_RT_diArg_1 and TRG_NLS_MonoExtN_4.[30] The TRG_RT_diArg_1 motif is a di Arginine retention/retrieving signal that is present on membrane proteins, where it serves for ER localization.[30] The TRG_NLS_MonoExtN_4 is a NLS classical nuclear localization signal, which is possessed by many nuclear proteins, indicating that the human FAM120AOS protein 1 is a nuclear protein.

Secondary structure

The secondary structure of the human FAM120AOS protein 1 was predicted by the I-TASSER server and shows 11 alpha helices as follows, in order of position: SER15-TRP18, PRO25-SER27, THR34-TRP40, ALA85-ARG88, LYS111-ALA121, CYS145-ARG155, HIS158-ALA163, LEU169-LYS171, PRO179-ARG198, PRO225-CYS233, and PRO246-PHE252.[31]

Tertiary and quaternary structure

The figure above depicts the iTasser predicted tertiary structure of the human FAM120AOS protein 1. Section A of the figure depicts the predicted tertiary structure, with a possible transmembrane domain highlighted. The purple end sticking out on the bottom left is the start of the coding region (e.g. the methionine), while the red end sticking out towards the left is the end of the strand. The image appears to have 11 alpha helices, represented by the thicker coiled domains. Section B of the figure depicts the predicted tertiary structure of the protein by 35% solvent accessible surface area, which appears white. Section C of the protein shows the secondary structure of the protein, with the alpha helices clearly shown in red. Section D of the protein shows the protein's charge distribution.

The tertiary structure of the human FAM120AOS protein 1 was predicted by the I-TASSER server with a C-score of -4.00.[31] It appears that the outermost parts of the protein are more solvent accessible, while the inner areas are less solvent accessible.[31] The protein appears to be primarily blue, again indicating that it is a basic structure.[31] The protein also indicated the presence of a peripheral likelihood of 1.48 at amino acid position 132.[32] The NUCDISC results indicated the presence of pat 7 PLKKTKS (4) starting at amino acid position 168.[32]

Gene regulation

Promoter

There are four different promoters for the human FAM120AOS protein 1, which are depicted in the table below.[33] The promoter used for further analysis below (GXP_1829163) is 1665 base pairs long from coordinates 93450944-93452608, with five coding transcripts.[33]

Table 2: Human FAM120A Protein 1 Promoters
Promoter Size (in base pairs) Coordinates Strand Coding Transcripts
GXP_9004065 1040 93437082-93438121 - None (non-coding only)
GXP_228179 1040 93446357-93447396 - None (non-coding only)
GXP_1829163 1665 93450944-93452608 - 5
GXP_2255852 1487 93453115-93454601 - 2

Transcription factor binding sites

The transcription factors described below were identified on the Human FAM120A protein 1 promoter.[34]

Table 3: Transcription Factors for Human FAM120A Protein 1 Promoter
Code Name Full Name Binding Matrix Score Start site End site
AP2F Activator protein 2 agcGCCAgacggcac 0.862 336 350
STEM Motif composed of binding sites for pluripotency or stem cell factors cccgtctGCATggcccact 0.912 255 273
ZF20 C2H2 Zinc finger transcription factors 20 tgcggttACCA 0.791 447 457
E2FF E2F-myc activator/cell cycle regulator tggacacggGATAatgg 0.754 29 45
ZF5F ZF5 POZ domain zinc finger ccctgaGCGCcccaggc 0.957 28 44
P53F P53 tumor suppressor tgcggttaccaaaggCAAGtcagtg 0.954 312 336
RXRF RXR heterodimer binding sites ttattgacctagGGTCatattatag 0.857 156 180
EBOX E-box binding factors attatccCGTGtccaga 0.901 466 482
ZF02 C2H2 Zinc finger transcription factors 2 caaaagcaCCCCcctacacccgc 0.933 91 113
AP1R MAF and AP1 related factors ttggttGCTGagaaatttctagtag 0.842 356 380
PLAG pleomorphic adenoma gene taggGGGGtgcttttgctttcct 0.871 114 136
KLFS Krueppel like transcription factors agagcttAAAGgattcttc 0.976 118 136
ETSF Human and murine ETS1 factors ttcagtgaGGAAagcaaaagc 0.933 196 216

Expression pattern

An immunohistochemical staining of the FAM120AOS protein in the human prostate using a FAM120AOS polyclonal antibody indicates the presence of FAM120AOS in the nucleus of glandular cells.[35]

In Homo sapiens (humans), the gene exhibits high levels of expression (in RPKM) in the colon, fat, placenta, prostate, and thyroid, as determined through quantitative transcriptomic analysis (RNA-Seq) with the following respective values: 12.598, 11.727, 10.978, 11.277, and 13.511.[6] During human fetal development, the gene exhibits the highest levels of expression in the intestine at 20 weeks and the lungs at 17 weeks, as determined through the use of circular RNA with the following respective mean RPKM values: 5.066 and 4.365.[7] The sequencing of RNA from 20 human tissues showed the highest levels of FAM120AOS expression in the placenta, prostate, and thyroid, with respective mean RPKM values of 7.057, 3.978, and 4.396.[9] Transcription profiling through high throughput sequencing of both individual and mixtures of 16 human tissues RNA also found high levels of FAM120AOS gene expression in the thyroid, with a mean RPKM of 9.518.[8]

The image above shows the expression pattern for the human FAM120AOS protein in a glioblastoma cell in regards to cyclophilin B (CypB) across 6 samples.[36] In the control group, the expression of FAM120AOS is high, with values in the 83rd percentile. However, in the CypB depletion experimental group, the expression of FAM120AOS is much lower at the 56th, 60th, and 69th percentiles. Therefore, FAM120AOS expression appears to be positively affected by the present of CypB in this glioblastoma multiforme cell line.
The image above shows the expression pattern for human FAM120AOS in colorectal cancer line SW480 in genotypes with and without SNAI1 overexpression across 4 samples.[37] In the cancer cell line with SNAI1 overexpression, there is a moderate amount of FAM120AOS expression at the 68th and 69th percentiles. In the control group, expression drops to the 52nd and 56th percentile. Therefore SNAI1 overexpression may be linked to FAM120AOS expression, possibly due to its function as a zinc finger protein.
The image above shows the expression pattern for FAM120AOS in human females and males both with and without type 2 diabetes.[38] For the males and females with normal glucose tolerance, there seems to be a relatively lower percentile of FAM120AOS expression, with one outlier that may be due to other underlying conditions. For males and females with type 2 diabetes, FAM120AOS gene expression is generally expressed at the 90th percentiles, while those with normal glucose tolerance generally have expression at the 10th percentile. Women with type 2 diabetes generally have FAM120AOS expression ranging from the 40th-98th percentile, while women with normal glucose tolerance generally have expression at the 10th percentile.

Transcript level regulation

The image above shows the presence of 4 stem loops on the 5' UTR of human FAM120AOS protein 1, along with the transcription start site, start codon, upstream (unused) polyadenylation signal and an area of conserved sequence across the human sequence and its strict orthologs.[39]

There are 4 large stem loops present in the 5' UTR of the human FAM120AOS protein 1.[40] There are 8 miRNA binding sites identified for the human FAM120AOS protein 1.[41]

Table 4: 3' UTR MicroRNA Binding Sites for Human FAM120AOS Protein 1[41]
miRNA Name miRNA sequence Target Score Seed Location
hsa-miR-4286 ACCCCACUCCUGGUACC 94 475
hsa-miR-3059-5p UUUCCUCUCUGCCCCAUAGGGUGU 88 199, 396
hsa-miR-3152 UGUGUUAGAAUAGGGGCAAUAA 87 173,735
hsa-miR-4499 AAGACUGAGAGGAGGGA 83 730
hsa-miR-129-2-3p AAGCCCUUACCCCAAAAAGCAU 83 1022
hsa-miR-129-1-3p AAGCCCUUACCCCAAAAAGUAU 83 1022
hsa-miR-6881-3p AUCCUCUUUCGUCCUUCCCACU 82 199, 395
hsa-miR-10400-3p CUGGGCUCCCGGACGAGGCGGG 81 337

Protein level regulation

The K-NN prediction results for the human FAM120AOS protein 1 predicted it to be present in the nucleus of cells.[32] There is a possible transmembrane domain for the protein, present from amino acid position 131-148.[42]

The image above shows the predicted transmembrane domain for the human FAM120AOS protein 1.[43]

Homology/evolution

There were no paralogs identified for human FAM120AOS.[4][10] The most distant homolog for human FAM120AOS detectable is the Microcebus murinus, with a 61.17% sequence identity to the human protein.[44] There was a total of 11 orthologs identified for human FAM120AOS protein 1.[45] No proteins with homologous domains to the human FAM120AOS sequence were identified.[46] FAM120AOS seems to be evolving at a moderate rate, in between that of cytochrome c and fibrinogen alpha.[4]

Table 5: Orthologs of Human FAM120AOS Isoform 1
Genus and species Common Name Taxonomic group Date of divergence (in MYA) Accession number Sequence length (in aa) Sequence Identity to human protein Sequence similarity to human protein
Homo sapiens Human Primates 0 NP_942138.2 256 100.00% 100%
Pan troglodytes Chimpanzee Primates 6.4 PNI17265.1 255 98.44% 100%
Pongo abelii Sumtran orangutan Primates 15.2 PNJ71424.1 253 95.70% 100%
Nomascus leucogenys Northern white-cheeked gibbon Primates 19.8 XP_030657822.1 73 94.12% 26%
Hylobates moloch Silvery gibbon Primates 19.8 XP_032020454.1 86 92.65% 26%
Trachypithecus francoisi Francois' leaf monkey Primates 28.81 XP_033092605.1 74 92.75% 26%
Rhinopithecus roxellana Golden snub-nosed monkey Primates 28.81 XP_030775307.1 74 92.75% 26%
Macaca nemestrina Southern pit-tailed macaque Primates 28.81 XP_024642522.1 74 92.75% 26%
Papio anubis Olive baboon Primates 28.81 XP_003912044.1 74 92.30% 26%
Carlito syrichta Philippine tarsier Primates 69 XP_021572479.1 236 66.82% 78%
Microcebus murinus Mouse lemur Primates 74.1 XP_020144792 274 61.17% 76%
Muntiacus muntjak Indian muntjac Artiodactyla 94 KAB0347543.1 161 97.18% 27%
The time calibrated unrooted phylogenetic tree above shows the phylogeny of the FAM120AOS gene across its strict orthologs. The gene seems to have first appeared between a common ancestor of Homo sapiens (humans) and Microcebus murinus (mouse lemur), which diverged from one another approximately 74.1 million years ago (MYA).[47]
The approximate date of divergence (from human) for a given species versus corrected divergence for FAM120AOS isoform 1, cytochrome c, and fibrinogen alpha across all identified orthologs.

Function/biochemistry

The function and biochemistry of the human FAM120AOS protein are currently unknown.[4][10] The single nucleotide polymorphisms (SNPs) did not show any mutations in conserved amino acids, so it is lis likely that two copies of the FAM120AOS gene are necessary for proper function.

Interacting proteins

The FAM120AOS protein is physically associated with the following proteins: MDFI, ELAV1, TRIM25, and APEX1.[48][49][50][51][10]

Clinical significance

A missense mutation in the FAM120AOS protein from amino acid threonine at position 248 to isoleucine (T248I) has been linked in one whole-of-exome sequencing study to: coarse facial features, scoliosis, pectus excavatum, skin laxity, hypotonia, GERD, hyperreactive airway disease,[lower-alpha 1] and undescended testicles.[52]

The image above shows the SNPs for human FAM120AOS isoform 1, with stars representing significant missense mutations and triangles representing significant point mutations.[53]

Notes

  1. Elsewhere, Alazami et al. narrow the description of the reported "chronic lung disease" of this participant to "hyperactive airways" instead.[lower-alpha 2] This alternative designation appears in the Supplemental Information of the article.[lower-alpha 3] In the main body of the article (at Table 2, pp. 156–157), the phenotype of the individual possessing the candidate gene mutation includes "chronic lung disease". However, chronic lung—or chronic respiratory diseases—are specified by various authorities as particular diseases or conditions, and do not include "hyperactive airways". According to the Open Targets Platform,[lower-alpha 4] the thoracic societies of the United States (ATS) and Britain (BTS) list chronic lung disease as: fibrosis, bronchiectasis, bullae, emphysema, and nodular or lymphomatous abnormalities. The Australian Institute of Health and Welfare gives asthma, COPD, allergic rhinitis, bronchiectasis, chronic sinusitis, cystic fibrosis, occupational lung diseases, and pulmonary fibrosis as chronic respiratory conditions.[lower-alpha 5]
  2. Alazami AM, Patel N, Shamseldin HE, et al. (January 2015). "Supplemental Information: Document S1 - Figures S1 and S2 and Table S2 of 'Accelerating novel candidate gene discovery in neurogenetic disorders'" (PDF). Cell Reports. 10 (2): 148–161. doi:10.1016/j.celrep.2014.12.015. PMID 25558065. Unpaginated: appears under heading "Family: 12DG0321; Gene: FAM120AOS".
  3. Open Targets Platform. "Evidence for FAM120AOS in chronic lung disease". platform.opentargets.org.
  4. AIHW (28 July 2020). "About Chronic respiratory conditions". Australian Institute of Health and Welfare. Government of Australia. Version: v9.0. Retrieved 9 February 2022.

References

  1. GRCh38: Ensembl release 89: ENSG00000188938 - Ensembl, May 2017
  2. "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  3. "AceView: Gene:FAM120AOS, a comprehensive annotation of human, mouse and worm genes with mRNAs or ESTsAceView". www.ncbi.nlm.nih.gov. Retrieved 2020-10-04.
  4. "FAM120AOS family with sequence similarity 120A opposite strand [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-10-04.
  5. "GDS3834 / 7875". www.ncbi.nlm.nih.gov. Retrieved 2020-12-18.
  6. Fagerberg L, Hallström BM, Oksvold P, Kampf C, Djureinovic D, Odeberg J, et al. (February 2014). "Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics". Molecular & Cellular Proteomics. 13 (2): 397–406. doi:10.1074/mcp.M113.035600. PMC 3916642. PMID 24309898.
  7. Szabo L, Morey R, Palpant NJ, Wang PL, Afari N, Jiang C, et al. (June 2015). "Statistically based splicing detection reveals neural enrichment and tissue-specific induction of circular RNA during human fetal development". Genome Biology. 16: 126. doi:10.1186/s13059-015-0690-5. PMC 4506483. PMID 26076956.
  8. "Illumina bodyMap2 transcriptome (ID 204271) - BioProject - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-18.
  9. Duff MO, Olson S, Wei X, Garrett SC, Osman A, Bolisetty M, et al. (May 2015). "Genome-wide identification of zero nucleotide recursive splicing in Drosophila". Nature. 521 (7552): 376–379. Bibcode:2015Natur.521..376D. doi:10.1038/nature14475. PMC 4529404. PMID 25970244.
  10. "FAM120AOS Gene - F120S Protein - F120S Antibody". www.genecards.org. Retrieved 2020-10-04.
  11. NCBI (2020-10-12). "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 1, mRNA - NCBI Reference Sequence: NM_198841.4". GenBank Nucleotide.
  12. "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 1, mRNA". 2020-10-12. {{cite journal}}: Cite journal requires |journal= (help)
  13. "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 2, mRNA". 2020-12-12. {{cite journal}}: Cite journal requires |journal= (help)
  14. "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 3, non-coding RNA". 2020-07-23. {{cite journal}}: Cite journal requires |journal= (help)
  15. "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 4, non-coding RNA". 2020-07-23. {{cite journal}}: Cite journal requires |journal= (help)
  16. "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 6, non-coding RNA". 2020-07-25. {{cite journal}}: Cite journal requires |journal= (help)
  17. "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 7, non-coding RNA". 2020-07-25. {{cite journal}}: Cite journal requires |journal= (help)
  18. "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 8, non-coding RNA". 2020-07-25. {{cite journal}}: Cite journal requires |journal= (help)
  19. "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 9, non-coding RNA". 2020-07-25. {{cite journal}}: Cite journal requires |journal= (help)
  20. "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 10, non-coding RNA". 2020-07-25. {{cite journal}}: Cite journal requires |journal= (help)
  21. "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 11, non-coding RNA". 2020-07-25. {{cite journal}}: Cite journal requires |journal= (help)
  22. "Uncharacterized protein FAM120AOS isoform 1 [Homo sapiens] - Protein - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-18.
  23. "Uncharacterized protein FAM120AOS isoform 2 [Homo sapiens] - Protein - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-18.
  24. Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A (July 2003). "ExPASy: The proteomics server for in-depth protein knowledge and analysis". Nucleic Acids Research. 31 (13): 3784–8. doi:10.1093/nar/gkg563. PMC 168970. PMID 12824418.
  25. "Compute pI/MW - SIB Swiss Institute of Bioinformatics". www.Expasy.org. Retrieved 2020-12-19.
  26. "Dotlet JS". dotlet.vital-it.ch. Retrieved 2020-12-18.
  27. "Clustal Omega < Multiple Sequence Alignment < EMBL-EBI". www.ebi.ac.uk. Retrieved 2020-12-19.
  28. "EBI Tools". www.ebi.ac.uk. Retrieved 2020-12-19.
  29. "Clustal Omega < Multiple Sequence Alignment < EMBL-EBI". www.ebi.ac.uk. Retrieved 2020-12-19.
  30. "ELM". elm.eu.org. Retrieved 2020-12-19.
  31. "I-TASSER server for protein structure and function prediction". zhanglab.ccmb.med.umich.edu. Retrieved 2020-12-19.
  32. "PSORT II Prediction". psort.hgc.jp. Retrieved 2020-12-19.
  33. "Gene2Promoter". www.genomatix.de. Retrieved 2020-12-19.
  34. "MatInspector: Search for transcription factor binding sites". www.genomatix.de. Retrieved 2020-12-19.
  35. "FAM120AOS Antibodies". ThermoFisher Scientific.{{cite web}}: CS1 maint: url-status (link)
  36. "GEO Profiles - 104737339 - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  37. "GEO Profiles - 100460041 - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  38. "104737339 - GEO Profiles - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  39. "104737339 - GEO Profiles - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  40. "RNAfold web server". rna.tbi.univie.ac.at. Retrieved 2020-12-19.
  41. "miRDB - Custom Prediction". mirdb.org. Retrieved 2020-12-19.
  42. "EBI Tools: Job not available". www.ebi.ac.uk. Retrieved 2020-12-19.
  43. "104737339 - GEO Profiles - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  44. "LOW QUALITY PROTEIN: uncharacterized protein FAM120AOS [Microcebus mur - Protein - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  45. "BLAST: Basic Local Alignment Search Tool". blast.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  46. "Human BLAT Search". genome.ucsc.edu. Retrieved 2020-12-19.
  47. "TimeTree:The Timescale of Life". timetree.org. Retrieved 2020-10-25.
  48. "MDFI - MyoD family inhibitor, isoform CRA_a - Homo sapiens (Human) - MDFI gene & protein". www.uniprot.org. Retrieved 2020-12-19.
  49. "ELAVL1 - ELAV-like protein 1 - Homo sapiens (Human) - ELAVL1 gene & protein". www.uniprot.org. Retrieved 2020-12-19.
  50. "TRIM25 Gene - TRI25 Protein -TRI25 Antibody". www.genecards.org. Retrieved 2020-12-19.
  51. "FAM120AOS (RP11-165J3.1) Result Summary - BioGRID". thebiogrid.org. Retrieved 2020-12-19.
  52. Alazami AM, Patel N, Shamseldin HE, Anazi S, Al-Dosari MS, Alzahrani F, et al. (January 2015). "Accelerating novel candidate gene discovery in neurogenetic disorders via whole-exome sequencing of prescreened multiplex consanguineous families". Cell Reports. 10 (2): 148–61. doi:10.1016/j.celrep.2014.12.015. PMID 25558065.
  53. "SNP linked to Gene (geneID:158293) Via Contig Annotation". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
This article is issued from Wikipedia. The text is licensed under Creative Commons - Attribution - Sharealike. Additional terms may apply for the media files.